View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13217_high_14 (Length: 290)
Name: NF13217_high_14
Description: NF13217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13217_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 13 - 273
Target Start/End: Complemental strand, 41878810 - 41878550
Alignment:
| Q |
13 |
tgagctgaacttttgccatgaaaaccctgcaccaaaacctttttcctgttgcaactttggtttctcatcctcatcaggattttgatttgttgtagcaacc |
112 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41878810 |
tgagctgaacttttcccatgaaaaccctgcaccaaaaccttttgtctgttgcaactttggtttctcatcctcatcaggattttgatttgttgtagcaacc |
41878711 |
T |
 |
| Q |
113 |
tgtgtgcttaacttttgccttgaaaccctgcacgaaaagctttagccttgttcaaaatgtcttctatcgaagtgtcagtttcctttgccttctcttaata |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
41878710 |
tgtgtgcttaacttttgccttgaaaccctgcacgaaaagctttagccttgttcaaaatgtcttctatcgaagtgtcggttgcctttgccttctcttaatc |
41878611 |
T |
 |
| Q |
213 |
ttctttagctagattagaaacttgtgcttcttgctttgaaaactgtagtgcctcttcttcc |
273 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
41878610 |
ttctttagctagattagaagcttgtgcttcttgctttgaaagctttagtgcctcttcttcc |
41878550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 61 - 155
Target Start/End: Complemental strand, 41878863 - 41878769
Alignment:
| Q |
61 |
ttgcaactttggtttctcatcctcatcaggattttgatttgttgtagcaacctgtgtgcttaacttttgccttg-aaaccctgcacgaaaagcttt |
155 |
Q |
| |
|
||||| |||||| ||||||||||||| ||| ||||| ||| |||||||||||||| ||| ||||||| || || ||||||||||| |||| |||| |
|
|
| T |
41878863 |
ttgcacctttgggttctcatcctcat-aggcttttggattgctgtagcaacctgtgagctgaacttttcccatgaaaaccctgcaccaaaaccttt |
41878769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 13 - 273
Target Start/End: Complemental strand, 24213728 - 24213467
Alignment:
| Q |
13 |
tgagctgaacttttgccatgaaaaccctgcaccaaaacctttttcctgttgcaactttggtttctcatcctcatcaggattttgatttgttgtagcaacc |
112 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24213728 |
tgagctgaactttttccatgaaaaccctgcaccaaaaccttttgcctgttgcaactttggtttctcatcctcatcaggattttgatttgttgtagcaacc |
24213629 |
T |
 |
| Q |
113 |
tgtgtgcttaacttttgccttg-aaaccctgcacgaaaagctttagccttgttcaaaatgtcttctatcgaagtgtcagtttcctttgccttctcttaat |
211 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| ||| | ||| ||||||||||| || |
|
|
| T |
24213628 |
tgtgagcttaacttttgccttgaaaaccctgcacgaaaagctttagccttgttcaaaatgtcttctaccgaagttccagctgcctctgccttctcttgat |
24213529 |
T |
 |
| Q |
212 |
attctttagctagattagaaacttgtgcttcttgctttgaaaactgtagtgcctcttcttcc |
273 |
Q |
| |
|
||||||| ||||||||||| | ||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
24213528 |
cttctttaactagattagaagcctgtgcttcttgctttgaaagcttcagtgcctcttcttcc |
24213467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 13 - 273
Target Start/End: Original strand, 8758228 - 8758489
Alignment:
| Q |
13 |
tgagctgaacttttgccatgaaaaccctgc--accaaaacctttttcctgttgcaactttggtttctcatcctcatcaggattttgatttgttgtagcaa |
110 |
Q |
| |
|
|||| ||||||||||||||||| ||||||| ||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8758228 |
tgagttgaacttttgccatgaacaccctgcgcaccaaaaccttttgcctgttgcacctttggtttctcatcctcatcaggattttgatttgttgtagcaa |
8758327 |
T |
 |
| Q |
111 |
cctgtgtgcttaacttttgccttgaaaccctgcacgaaaagctttagccttgttcaaaatgtcttctatcgaagtgtcagtttcctttgccttctcttaa |
210 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| ||| ||| ||||||||| | | |
|
|
| T |
8758328 |
cctgtgggcttaacttttgccttgaaaccctgcacg-aaagctttagccttgttcaaaatgtcttctaccgaagtgtcggttgcctctgccttctcctga |
8758426 |
T |
 |
| Q |
211 |
tattctttagctagattagaaacttgtgcttcttgctttgaaaactgtagtgcctcttcttcc |
273 |
Q |
| |
|
| ||||||||||||||||||| | ||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
8758427 |
tcttctttagctagattagaagcctgtgcttcttgctttgaaagcttcagtgcctcttcttcc |
8758489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 61 - 160
Target Start/End: Complemental strand, 24213782 - 24213682
Alignment:
| Q |
61 |
ttgcaactttggtttctcatcctcatcaggattttgatttgttgtagcaacctgtgtgcttaacttttgccttg-aaaccctgcacgaaaagctttagcc |
159 |
Q |
| |
|
||||| |||||| |||||||||||||||| ||||| ||| |||||||||||||| ||| ||||||| || || ||||||||||| |||| |||| ||| |
|
|
| T |
24213782 |
ttgcacctttgggctctcatcctcatcaggcttttggattgctgtagcaacctgtgagctgaactttttccatgaaaaccctgcaccaaaaccttttgcc |
24213683 |
T |
 |
| Q |
160 |
t |
160 |
Q |
| |
|
| |
|
|
| T |
24213682 |
t |
24213682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 61 - 136
Target Start/End: Original strand, 8758174 - 8758249
Alignment:
| Q |
61 |
ttgcaactttggtttctcatcctcatcaggattttgatttgttgtagcaacctgtgtgcttaacttttgccttgaa |
136 |
Q |
| |
|
||||| |||||| ||||||||||||||||| ||||| ||| ||||||||||| || | | |||||||||| |||| |
|
|
| T |
8758174 |
ttgcacctttgggttctcatcctcatcaggcttttggattgctgtagcaacctttgagttgaacttttgccatgaa |
8758249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University