View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13217_low_11 (Length: 383)
Name: NF13217_low_11
Description: NF13217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13217_low_11 |
 |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 14 - 334
Target Start/End: Complemental strand, 42092111 - 42091786
Alignment:
| Q |
14 |
caaagggagatttgaatgaggaagtgacaagaggctgtgaagaaatagaaggcaaagcagagaaagatccactgccattactagttggtgtgggaagttc |
113 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42092111 |
caaaaggagatttgaatgaggaagtgacaagaggctgtgaagaaatagaagacaaagcagagaaagatccaccgccattactagttggtgtgggaagttc |
42092012 |
T |
 |
| Q |
114 |
cacaggctttcttgaacggtttctaccacgatgcatgtgtctttcacagtacttttgtccagccaccacatccctcgcacaccgccactttttaccgtct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42092011 |
cacaggctttcttgaacggtttctaccacgatgcatgtgtctttcacagtacttttgtccagccaccacatccctcgcacaccgccactttttaccgtct |
42091912 |
T |
 |
| Q |
214 |
gttctccggcaacgacctggctctggatccattgctcctcttccccaatacccactttgcaacactaataaaacaca-----aaacnnnnnnnntattct |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
42091911 |
gttctccggcaacgacctggctctggatccattgctcctcttccccaatacccactttgcaacactaataaaacacaaaacaaaacaaaacaaatattct |
42091812 |
T |
 |
| Q |
309 |
aaatatacctcattttggggaatatt |
334 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
42091811 |
aaatatacctcattttggggaatatt |
42091786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 338 - 368
Target Start/End: Complemental strand, 42091706 - 42091676
Alignment:
| Q |
338 |
tgagagaaaccaagtagtagaatgaaactta |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42091706 |
tgagagaaaccaagtagtagaatgaaactta |
42091676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 109 - 168
Target Start/End: Original strand, 7246546 - 7246605
Alignment:
| Q |
109 |
agttccacaggctttcttgaacggtttctaccacgatgcatgtgtctttcacagtacttt |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
7246546 |
agttccacaggctttcttgaacggtttctacctctgtgcatgtgtctttcacagtacttt |
7246605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 52052075 - 52052018
Alignment:
| Q |
111 |
ttccacaggctttcttgaacggtttctaccacgatgcatgtgtctttcacagtacttt |
168 |
Q |
| |
|
||||||||||||||||||||||||| | || | ||||||||| ||||||||||||||| |
|
|
| T |
52052075 |
ttccacaggctttcttgaacggtttttccctctatgcatgtgcctttcacagtacttt |
52052018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 111 - 164
Target Start/End: Original strand, 18199801 - 18199854
Alignment:
| Q |
111 |
ttccacaggctttcttgaacggtttctaccacgatgcatgtgtctttcacagta |
164 |
Q |
| |
|
||||||||||||||||||||||||| | || | ||||||||||||||||||||| |
|
|
| T |
18199801 |
ttccacaggctttcttgaacggttttttcctctatgcatgtgtctttcacagta |
18199854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 111 - 167
Target Start/End: Complemental strand, 399189 - 399133
Alignment:
| Q |
111 |
ttccacaggctttcttgaacggtttctaccacgatgcatgtgtctttcacagtactt |
167 |
Q |
| |
|
|||||||||||||||||||||||| | ||||| |||||||| | ||||||||||| |
|
|
| T |
399189 |
ttccacaggctttcttgaacggttgcggccacggtgcatgtggcgctcacagtactt |
399133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University