View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13217_low_13 (Length: 334)
Name: NF13217_low_13
Description: NF13217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13217_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 313
Target Start/End: Complemental strand, 13019589 - 13019309
Alignment:
| Q |
18 |
cgaactgcagaacagtctctgcagttcgattttgaaaacattgtaatttgtacttttcccaacgtaagtctgtcgttgggaaaagcaggagtagttacta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | ||||||||||| |||| ||||||||||||||| |
|
|
| T |
13019589 |
cgaactgcagaacagtctctgcagttcgattttgaaaacattgttatttgtacttttcccaacgacactctgtcgttggaaaaaacaggagtagttacta |
13019490 |
T |
 |
| Q |
118 |
ctacttttaaaccggagagattgaactcagtcacatcattaaactcactaaacgacggctcatttttatcgtcgattgagtgttttaacgatgtgatggt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
13019489 |
ctacttttaaaccggagagattgaactcagtcacatcgttaaactca---------------tttttatcgtctatagagtgttttaacgatgtgatggt |
13019405 |
T |
 |
| Q |
218 |
tctggagattgctgatgacagatcattactgcgttgttggaagaaagttttgagtgttgatggaattgtttcgtttggggggtgtgaatttgaaat |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13019404 |
tctggagattgctgatgacagatcattactgcgttgttggaagaaagttttgagtgttgatggaattgtttcgtttggggggtgtgaatttgaaat |
13019309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University