View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13218_high_18 (Length: 402)
Name: NF13218_high_18
Description: NF13218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13218_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 7 - 359
Target Start/End: Original strand, 45373939 - 45374287
Alignment:
| Q |
7 |
gtgagaagaacaatggtagaggaactcggttatgatgcatggagaggttatggttttgtgtgaagtcgagggtgattgttgggaagggctgagaagctga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45373939 |
gtgagaagaacaatggtagaggaactcggttatgatgcatggagaggttatggttttgtgtgaagtcgagggtgattgttgggaagggctgagaagctga |
45374038 |
T |
 |
| Q |
107 |
tagggttgaggttgcgattgttgcatagggaaatgaattagataaatatcctgttgctgattcctttcttagtgttgatgaggttgaacttgatagcagc |
206 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45374039 |
tagggttgaggttgccattgttgcatagggaaatgaattagataaataacctgttgctgattcctttcttagtgttgatgaggttgaacttgatagcagc |
45374138 |
T |
 |
| Q |
207 |
attgctgcagctgctgatgttgtgtgtgctatggcagttgcagctggtgggagtgggtgattgtggttgccttcatatgttgttattagtattgtcttgt |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45374139 |
attgctgcagctgctgatgttgtgtgtgctatggcagttgcagctggtgggagtgggtgattgtggttgccttcatatgttgttattagtattgtcttgt |
45374238 |
T |
 |
| Q |
307 |
cttctgcacatctttggacctgttcaagaaacaaattaagtgcacatatacta |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45374239 |
cttctgcacatctttggacctgttcaagaaaca----aagtgcacatatacta |
45374287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 276 - 329
Target Start/End: Complemental strand, 37054065 - 37054012
Alignment:
| Q |
276 |
ccttcatatgttgttattagtattgtcttgtcttctgcacatctttggacctgt |
329 |
Q |
| |
|
|||||||||||||| || |||||||| |||||||| ||||| ||||| |||||| |
|
|
| T |
37054065 |
ccttcatatgttgtgataagtattgttttgtcttcagcacacctttgtacctgt |
37054012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University