View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13218_low_32 (Length: 271)
Name: NF13218_low_32
Description: NF13218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13218_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 15 - 257
Target Start/End: Original strand, 54012372 - 54012614
Alignment:
| Q |
15 |
tcaatactttcatcaggtgctgcaattgtagagaccgttaaacttaaagagaaacttttagaatagatgaccgacctgaaagccacatcgcggtacaacc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54012372 |
tcaatactttcatcaggtgctgcaattgtagagaccgttaaacttagagagaaacttttagaatagatgaccgacctgaaagccacatcgcggtacaacc |
54012471 |
T |
 |
| Q |
115 |
caggtttggtggagtctacctcggaggtaatagaaactaagtaaaaatgttttggaccaaagccacattgccatcacaactaaaaaggttaccggcaaac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
54012472 |
caggtttggtggagtctacctcggaggtaatagaaactaagtaaaaatgttttggaccaaagccacattgccatcacaactaaaaaggttactggcaaac |
54012571 |
T |
 |
| Q |
215 |
atgggatgaagaagagtcttgtagtgtatgcaaatgaagaagc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54012572 |
atgggatgaagaagagtcttgtagtgtatgcaaatgaagaagc |
54012614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University