View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13218_low_42 (Length: 220)
Name: NF13218_low_42
Description: NF13218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13218_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 7 - 101
Target Start/End: Complemental strand, 11825700 - 11825605
Alignment:
| Q |
7 |
gaacgggagttacttgaagattacccacttttgcagcctttgtaaattgtaatggcatgcttgtttttatgtcatc-taagttagttcaaccacaa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11825700 |
gaacgggagttacttgaagattacccacttttgcagcctttgtaaattgtaatggcatgcttgtttttatgtcatcttaagttagttcaaccacaa |
11825605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 23093586 - 23093413
Alignment:
| Q |
1 |
ctctcagaacgggagttacttgaagattacccacttttgcagcctttgtaaattgtaatggcatgcttg-------------------tttttatgtcat |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23093586 |
ctctcagaacgggagttacttgaagattacccacttttgcagcctttgtaaattgtaatggcatgcttgttttctgcttccgtgcttgtttttatgtcat |
23093487 |
T |
 |
| Q |
82 |
ctaagttagttcaaccacaannnnnnnnctaacattactaattcaatcagtttaattttccgctatcggttatag |
156 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23093486 |
ctaagttagttcaaccacaa-attttttctaacattactaattcaatcagtttacttttccgctatcggttatag |
23093413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 123 - 156
Target Start/End: Complemental strand, 11825596 - 11825563
Alignment:
| Q |
123 |
ttcaatcagtttaattttccgctatcggttatag |
156 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
11825596 |
ttcaatcagtttacttttccgctatcggttatag |
11825563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 47348568 - 47348640
Alignment:
| Q |
1 |
ctctcagaacgggagttacttgaagattacccacttttgcagcctttgtaaattgtaatggcatgcttgtttt |
73 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
47348568 |
ctctcggaacgggagttacttgaagattacccacttttgcggcctttgtaaattgtaatggaatgcttgtttt |
47348640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University