View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13218_low_43 (Length: 216)
Name: NF13218_low_43
Description: NF13218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13218_low_43 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 25010750 - 25010546
Alignment:
| Q |
1 |
cttttataatcaaaaacatttaatggagtgtataacactcttcttaaacagtttttccctctagaaccacttgttatcaagaccgtaaaaacaaattcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25010750 |
cttttataatcaaaaacatttaatggagtgtataacactcttcttaaacagtttttccctctagaaccacttgttatcaagaccgtaaaaacaaattcat |
25010651 |
T |
 |
| Q |
101 |
cagaaaagaacgttgtaaggtatcaaagagcaaacgagtagaacggccaacgattagattacactgaaagtgataaagaaagggtatgcccgaggccaca |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
25010650 |
cagaaaagaacattgtaaggtatcaaagagcaaacgagtagaacggccaacgattagattacactcaaagtaataaagaaagggtatgcccgaggccaca |
25010551 |
T |
 |
| Q |
201 |
ggttc |
205 |
Q |
| |
|
||||| |
|
|
| T |
25010550 |
ggttc |
25010546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University