View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13219_high_11 (Length: 284)
Name: NF13219_high_11
Description: NF13219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13219_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 24984753 - 24985023
Alignment:
| Q |
1 |
caattttttcattttattctcgttttagattttataatccaaacaatacgtccataccaacatatacacactttcactcatttcccattttcaaaattta |
100 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24984753 |
caattttttcattttattatcgttttacattttataatccaaacaatacgtccataccaacatatacacactttcactcatttcccattttcaaaattta |
24984852 |
T |
 |
| Q |
101 |
atccaaggatgcagcgctgccggaaggcaaacctatgagtggctttagatattagacatttatacaacatttttaagattaatttgccagataattggtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24984853 |
atccaaggatgcagcgctgccggaaggcaaatctatgagtggctttagatattagacatttatacaacatttttaagattaatttgccagataattggtg |
24984952 |
T |
 |
| Q |
201 |
ttgtggctatcatttgcttaatagtttatctcatttggattatatttgaataagttttttaggataatatt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24984953 |
ttgtggctatcatttgcttaatagtttatctcatttggattatatttgaataagttttttaggataatatt |
24985023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University