View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13219_low_15 (Length: 242)
Name: NF13219_low_15
Description: NF13219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13219_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 28675537 - 28675298
Alignment:
| Q |
1 |
cagaagcttcaatgaaaaatggttcaaaagaatcacatatagaagaagaagaagaggaa------------aataacagagtatttaaagctaaagtttt |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
28675537 |
cagaagcttcaatgaaaaatggttcaaaagaatcatatatagaagaagaagaagaagaagaagaagaagaaaataacagagtatttaaagctaaagtttt |
28675438 |
T |
|
| Q |
89 |
agtttctgattctaatgattcttccactttttgttctactccaccaaaaaatgctttgttactaactagatgcaaatcagcaccatatagttcatcttca |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28675437 |
agtttctgattctaatgattcttccactttttgttctactccaccaaaaaatgctttgttactaactagatgcaaatcagcaccatatagttcatcttca |
28675338 |
T |
|
| Q |
189 |
ctagcaagtaggttttggggttctcctttaaggaatgaag |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28675337 |
ctagcaagtaggttttggggttctcctttaaggaatgaag |
28675298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University