View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1321_high_19 (Length: 230)
Name: NF1321_high_19
Description: NF1321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1321_high_19 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 51 - 230
Target Start/End: Complemental strand, 24492668 - 24492487
Alignment:
| Q |
51 |
tcgatttgaaaatgagtttgaactacttgtggagcttcacctagagtgtgaattgagttcacattaaaataattcaatacaaaatttacacttatatc-- |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
24492668 |
tcgatttgaaaatgagtttgaactacttgtggaccttcacctagagtgtgaattgagttcacattaaaataattcaatacaaaatttacccttatctcta |
24492569 |
T |
 |
| Q |
149 |
tctatggccaagtttcacgttattttggtgcttaatgatcagtaacagactatgaattgagttccataaatgcataataatt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24492568 |
tctatggccaagtttcacgttattttggtgcttaatgatcagtaacagactatgaattgagttccataaatgaataataatt |
24492487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University