View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1321_low_24 (Length: 251)
Name: NF1321_low_24
Description: NF1321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1321_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 36253358 - 36253598
Alignment:
| Q |
1 |
ccttcaacagttcaatctcatcctgcttcgtccatagcctctgatattgtttaacgccgtctgaatactttttgttatattgtcgttttgagcgtgttgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36253358 |
ccttcaacagttcaatctcatcctgcttcgtccatagcctctgatattgtttaactccgtctgaatactttttgttatattgtcgttttgagcgtgttgt |
36253457 |
T |
|
| Q |
101 |
tatagtggtagtagccgaggtggtggctgtgtttgttgccgcgtttgtgtcatctgcgggggcagccatggccaccgtcacaacgggggatgcatcagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36253458 |
tatagtggtagtagccgaggtggtggctgtgtttgttgccgcgtttgtgtcatctgcgggggcagccatggccaccgtcacaacgggggatgcatcagaa |
36253557 |
T |
|
| Q |
201 |
acggcaagtgcaatgggaatgttgtccatttggtcttcatc |
241 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36253558 |
acggcaagtgcaatgggaatattgtccatttggtcttcatc |
36253598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University