View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1321_low_9 (Length: 318)
Name: NF1321_low_9
Description: NF1321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1321_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 104 - 308
Target Start/End: Original strand, 35601052 - 35601256
Alignment:
| Q |
104 |
ttgctcctagatagttcggtagctctccaccagaacctagaagaagctttatcagcctttcattatcactctcaaattgaactttattgaagccacactc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35601052 |
ttgctcctagatagttcggtagctctccaccagaaccttgaagaagctttatcagcctttcattatcactctcaaattgaactttattgaagccacactc |
35601151 |
T |
 |
| Q |
204 |
atgagcaaagtgaaccgcttggtacagaccccaagcttctgcagttccagcgcattggaacccaagccgcatccaagttcctgatgccatcactagacct |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35601152 |
atgagcaaagtgaaccgcttggtacagaccccaagcttctgcagttcctgcgcagtggaacccaagccgcatccaagttcctgatgccatcactagacct |
35601251 |
T |
 |
| Q |
304 |
tcatc |
308 |
Q |
| |
|
||||| |
|
|
| T |
35601252 |
tcatc |
35601256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 62
Target Start/End: Original strand, 35601010 - 35601042
Alignment:
| Q |
30 |
attgtcacatcttttaatatgagaaaaagaaca |
62 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
35601010 |
attgccacatcttttaatatgagaaaaagaaca |
35601042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University