View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13221_low_18 (Length: 226)

Name: NF13221_low_18
Description: NF13221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13221_low_18
NF13221_low_18
[»] chr8 (1 HSPs)
chr8 (55-226)||(13211868-13212039)


Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 55 - 226
Target Start/End: Original strand, 13211868 - 13212039
Alignment:
55 cacatgctaccttctgctgcttcatttggaagcaactaagaacatttttagctgaacaagaaaattaatttaactgttttggatgcaatatcataaaatt 154  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13211868 cacatgctaccttctgctgcttcatttggaagcaactaagaacatttttagctgaacaagaaaattaatttaactgttttggatgcaatatcataaaatt 13211967  T
155 caaaccccacaaaaaattcatgaatttatacatccttctttcaattcaacatcatcaagtagtcaacttaat 226  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13211968 caaaccccacaaaaaattcatgaatttatacatccttctttcaattcaacatcatcaagtagtcaacttaat 13212039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University