View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13222_high_26 (Length: 227)
Name: NF13222_high_26
Description: NF13222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13222_high_26 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 52 - 227
Target Start/End: Original strand, 6489202 - 6489377
Alignment:
| Q |
52 |
ggttcggtttcttcattgtcacagaagagagatgcaatctgctttaatggatccaaattcaattgagaataaccgttttgatggtgctgagttccgcatt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6489202 |
ggttcggtttcttcattgtcacagaagagagatgcaatctgctttaatggatccaaattcaattgagaataaccgttttgatggtgctgagttccgcatt |
6489301 |
T |
 |
| Q |
152 |
cgtgactgcaaccgcaatttaatacagcattcattgacgacgttgttgctgctgccgtgatgtatctggtgtccgt |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6489302 |
cgtgactgcaaccgcaatttaatacagcattgattgatgacgttgttgctgctgccgtgatgtatctggtgtccgt |
6489377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 6489151 - 6489181
Alignment:
| Q |
1 |
tatttcatctctctatttcaaaatgtaactg |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6489151 |
tatttcatctctctatttcaaaatgtaactg |
6489181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University