View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13222_low_24 (Length: 236)

Name: NF13222_low_24
Description: NF13222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13222_low_24
NF13222_low_24
[»] chr1 (1 HSPs)
chr1 (64-213)||(16516124-16516275)


Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 64 - 213
Target Start/End: Complemental strand, 16516275 - 16516124
Alignment:
64 taatttttataaagagaaa-tgttaacgaatatctaaagtcaattgttataaa--tctaaagataaaattttatgttgaatccctcacaattaatttaga 160  Q
    ||||||||||||||||||| ||| |||||| |||| |||||||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||     
16516275 taatttttataaagagaaaatgtcaacgaacatctgaagtcaattgttataaaaatctaaagatgaaattttatgttgaatccctcacaattaatttagt 16516176  T
161 ggctttaacatactcattcaacc-tttctttaacaagaatagattgtcatccgt 213  Q
    |||||||||||   ||||||||| |||||||||||||||||||||||| |||||    
16516175 ggctttaacat--gcattcaaccttttctttaacaagaatagattgtcttccgt 16516124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University