View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13222_low_24 (Length: 236)
Name: NF13222_low_24
Description: NF13222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13222_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 64 - 213
Target Start/End: Complemental strand, 16516275 - 16516124
Alignment:
| Q |
64 |
taatttttataaagagaaa-tgttaacgaatatctaaagtcaattgttataaa--tctaaagataaaattttatgttgaatccctcacaattaatttaga |
160 |
Q |
| |
|
||||||||||||||||||| ||| |||||| |||| ||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16516275 |
taatttttataaagagaaaatgtcaacgaacatctgaagtcaattgttataaaaatctaaagatgaaattttatgttgaatccctcacaattaatttagt |
16516176 |
T |
 |
| Q |
161 |
ggctttaacatactcattcaacc-tttctttaacaagaatagattgtcatccgt |
213 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
16516175 |
ggctttaacat--gcattcaaccttttctttaacaagaatagattgtcttccgt |
16516124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University