View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13224_high_3 (Length: 239)
Name: NF13224_high_3
Description: NF13224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13224_high_3 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 38434697 - 38434485
Alignment:
| Q |
19 |
ctaactcactactgcaattgaaacgtcctcacactaccatccaaaaacacatgatggacaagtgtaaaacaatgttccaaggacttcttgaagaaacaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38434697 |
ctaactcactactgcaattgaaacgtcctcacactaccatccaaaaacacatgatggacaagtataaaacaatgttccaaggacttcttgaagaaacaat |
38434598 |
T |
|
| Q |
119 |
agcttccttatgtaattaactaattattaatttcaatgaaacacagtcaaaagctaaaggtctacttaaatggaggcttaattgcactttaaactcacca |
218 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38434597 |
agcttccttatg--------tgattattaatttcaatgaaacacagtcaaaagctaaaggtctacttaaattgaggcttaattgcactttaaactcacca |
38434506 |
T |
|
| Q |
219 |
aatatcatgattttgtgattt |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38434505 |
aatatcatgattttgtgattt |
38434485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University