View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13224_low_3 (Length: 259)
Name: NF13224_low_3
Description: NF13224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13224_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 245
Target Start/End: Original strand, 42839948 - 42840191
Alignment:
| Q |
19 |
agatgattgtaagaaatgcaatattcaaatcattgaaataaaagtacaaaaatagattcaatgttctcgcactttctgcaacttttctctcgattgtt-- |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42839948 |
agatgattgtaagaaatgcaatattcaaatcattgaaataaaagtacaaaaatagattcaatgttctcgcactttctgcaacttttctctcgattgtttt |
42840047 |
T |
|
| Q |
117 |
---------------ttctcaatgactgtatttggatttctactatttcatgatagctgtgtctactgcttatgattttcaatcttaatgcatatattaa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42840048 |
ctcaaagactatgttttctcaatgactgtatttggatttctactatttcatgatagctgtgtctactgcttatgattttcaatcttaatgcatatattaa |
42840147 |
T |
|
| Q |
202 |
accttcatttgttaatatgttgcatatgtgcatgcataggaagc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42840148 |
accttcatttgttaatatgttgcatatgtgcatgcataggaagc |
42840191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 121
Target Start/End: Original strand, 37406187 - 37406243
Alignment:
| Q |
65 |
caaaaatagattcaatgttctcgcactttctgcaacttttctctcgattgttttctc |
121 |
Q |
| |
|
||||| |||||||||||||||| | || |||||| ||||||||| ||||||||||| |
|
|
| T |
37406187 |
caaaattagattcaatgttctctcgctctctgcatattttctctcaattgttttctc |
37406243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University