View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13226_low_13 (Length: 250)
Name: NF13226_low_13
Description: NF13226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13226_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 31109655 - 31109897
Alignment:
| Q |
1 |
ttgaaatttataaacaaaattacaaacttcaatattgaaaagacaagcatttgattccccccgccaatgcattaataggattaagggattgataatttat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31109655 |
ttgaaatttataaacaaaattacaaacttcaatattgaaaagacaagcatttgattcccccagccaatgcattaataggattaagggattgataatttat |
31109754 |
T |
 |
| Q |
101 |
cctttaggcatat--ggaagctaatttgttagtttgtttgaaaagcttccacggttttgaggcatattctataatactaacctccaacattatttgatgt |
198 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31109755 |
cctttaggcatatatggaagctaatttgttagtttgtttgaaaagcttccacggttttgaggcatattctataatactaacctccaacattatttgatgt |
31109854 |
T |
 |
| Q |
199 |
gagaatgtactttaattttgatgaagaatatgttaccctatgc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31109855 |
gagaatgtactttaattttgatgaagaatatgttaccctatgc |
31109897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University