View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13227_high_5 (Length: 292)
Name: NF13227_high_5
Description: NF13227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13227_high_5 |
 | |
|
| [»] scaffold0768 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0768 (Bit Score: 124; Significance: 8e-64; HSPs: 2)
Name: scaffold0768
Description:
Target: scaffold0768; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 140 - 271
Target Start/End: Complemental strand, 384 - 253
Alignment:
| Q |
140 |
tatgtttgtccttttgctgcaagtgctgagaattgattgtattatacctataaaataagttttcatccactccatagacacatagccacacattgtataa |
239 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
384 |
tatgtttgtccttttgttgcaagtgctgagaattgattgtattatacctataaaataagttttcatccactccatagacacatagccacacattgtataa |
285 |
T |
|
| Q |
240 |
cctttttcaaagcaacatcttaccaccttttt |
271 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |
|
|
| T |
284 |
cctttttcaaagcaacatcttaccaccctttt |
253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0768; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 592 - 460
Alignment:
| Q |
1 |
gacaaaatttgtttaaatgtgacaaaaacatcgttttatgtgctttatnnnnnnnnt-ataatacttttgttttattcattttcattgtatctattgcaa |
99 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||| |||||||||| | ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
592 |
gacaaaatttgttaaaatgtgacaaaaacattgttttgtgtgctttataaaaaaaattataatacttttgtttcattcattttcattgtatctattgcaa |
493 |
T |
|
| Q |
100 |
cacaaaaaataaaatcgaaataaagaaagttca |
132 |
Q |
| |
|
|||| |||| ||| ||||||||||||||||||| |
|
|
| T |
492 |
cacacaaaaaaaattcgaaataaagaaagttca |
460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University