View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13228_high_10 (Length: 226)
Name: NF13228_high_10
Description: NF13228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13228_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 30804719 - 30804502
Alignment:
| Q |
1 |
cttcggttcagtaacgcaatagcaaggttctgatcccgaacctcccaagctgctcgggaccgagccaaattcagatctaaaagcagttttctctctccgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30804719 |
cttcggttcagtaacgcaatagcaaggttctgatcccgaacctcccaagctgttcgggaccgagccaaattcagatctaaaagcagttttctctctccgg |
30804620 |
T |
 |
| Q |
101 |
tgtctgttatcgaagctatatcgagttttgaaaccagatcagtggctcgttcgtagcatttcgcggcgagatcgaatttccggaggttatgccataacat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30804619 |
cgtctgttatcgaagctatatcgagttttgaaaccagatcagtggctcgttcgtagcatttcgcggcgagatcgaatttccggaggttatgccataacat |
30804520 |
T |
 |
| Q |
201 |
accagtcttgtagtagaa |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
30804519 |
accagtcttgtagtagaa |
30804502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University