View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13228_high_8 (Length: 257)
Name: NF13228_high_8
Description: NF13228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13228_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 40508882 - 40509097
Alignment:
| Q |
1 |
tcttccattcatggggtgaagtctaatattgatgtggcattattggtttgtgctatgtttggtacattcctaggattttggatgatgtaggatagagcag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40508882 |
tcttccattcatggggtgaagtctaatattgatgtggcattattggtttgtgctatgtttggtacattcctaggattttggatgatgtaggatagggcag |
40508981 |
T |
 |
| Q |
101 |
gacattttcaaggtgctttttagattatatttagtggtttggcagggttagttttgatttttgattaaattaaattgggatactcatttgcttgttatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
40508982 |
gacattttcaaggtgctttttagattatatttagtggtttggcagggttagttttggtttttgattaaattaaattgagacactcatttgcttgttatca |
40509081 |
T |
 |
| Q |
201 |
tgtaatgggataattt |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40509082 |
tgtaatgggataattt |
40509097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University