View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1322_high_21 (Length: 269)
Name: NF1322_high_21
Description: NF1322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1322_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 39 - 236
Target Start/End: Complemental strand, 8046256 - 8046062
Alignment:
| Q |
39 |
tgtgaggcacagaagaatgggttacccacttacctatagttgaatcaaggacactggtagtttcaactttcatggtatcaaataattgtttctgaaaatt |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8046256 |
tgtgaggcacagaagaatgggttacccacttacctatagttgaatcaaggacactggtagtttcaactttcatggtatcaaataattgtttctgaaaatt |
8046157 |
T |
 |
| Q |
139 |
atgctcactattgtttggtacaatatcactttcaatatatcatataataacattataatacctcttgtagatctgtcagttaacagttgctagtttat |
236 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || ||||||| ||||||||||||||||||||||||| |
|
|
| T |
8046156 |
atgttcactattgtttggtacaatatcactttcaatatatcat---ataacattataatacttcatgtagatgtgtcagttaacagttgctagtttat |
8046062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University