View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1322_high_29 (Length: 251)
Name: NF1322_high_29
Description: NF1322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1322_high_29 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 11 - 251
Target Start/End: Complemental strand, 30412320 - 30412079
Alignment:
| Q |
11 |
cagagaaaggacaaagtttactgtttttt-attttggaatttaatctcccattattttgaggaagataaagttgttaattacatcctttgatgtgaatat |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30412320 |
cagagaaaggacaaagtttactgtttttttattttggaatttaatctcccattattttgaggaagataaagttgttaattacatcctttgatgtgaatat |
30412221 |
T |
 |
| Q |
110 |
gttactattagatttgagttttcgttttctttgttttctattaattaaccagcttaaagaacatgatccgaaattatctactactaatctggaattcagg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30412220 |
gttactattagatttgagttttcgttttctttgttttcaattaattaaccagcttaaagaacatgatccgaaattatctactactaatctggaattcagg |
30412121 |
T |
 |
| Q |
210 |
cggatgttaagttcttttgattttgcttttttcgattgagtt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30412120 |
cggatgttaagttcttttgattttgcttttttcgattgagtt |
30412079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University