View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1322_high_30 (Length: 251)
Name: NF1322_high_30
Description: NF1322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1322_high_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 30 - 185
Target Start/End: Original strand, 21071128 - 21071285
Alignment:
| Q |
30 |
gatgtttatagaa-caactgattatcatgctgtaattaatttattagagtttgaatttaaattttcataagagatg---acaacagtaacttggttctat |
125 |
Q |
| |
|
||||||||||||| ||||||||||||||| | |||| |||||||||||||| |||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21071128 |
gatgtttatagaaacaactgattatcatgttctaatcaatttattagagttcgaatttgaattttcataagagatgatgacaacagtaacttggttctat |
21071227 |
T |
 |
| Q |
126 |
ccaaaacataatggttttctcttttctttgtgctattgaacaagaggaagctagtggatt |
185 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
21071228 |
ccaaaacataatggttttctc--ttctttgtgctactgagcaagaggaagctagtggatt |
21071285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 212
Target Start/End: Original strand, 21071386 - 21071414
Alignment:
| Q |
184 |
ttctctatgaattaggtgttatttgacta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21071386 |
ttctctatgaattaggtgttatttgacta |
21071414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University