View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1322_high_9 (Length: 404)
Name: NF1322_high_9
Description: NF1322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1322_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 3e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 3e-92
Query Start/End: Original strand, 122 - 301
Target Start/End: Original strand, 31009848 - 31010027
Alignment:
| Q |
122 |
ttattcttttgaaggaataggaatggttttgcctttggaatcagaagcaaaagataaagataaatttggtggagttttgggtttgggaatgtttctaatt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31009848 |
ttattcttttgaaggaataggaatggttttgcctttggaatcagaagcaaaagataaagataaatttggtggagttttgggtttgggaatgttcctaatt |
31009947 |
T |
 |
| Q |
222 |
tttctgttgtatggaggttttgctactttaggttactttgcttttggtgaagcaactcaagggattattactacaaatct |
301 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31009948 |
tttctattgtatggaggttttgctactttaggttactttgcttttggtgaagcaactcaagggattattactacaaatct |
31010027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University