View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1322_low_13 (Length: 404)

Name: NF1322_low_13
Description: NF1322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1322_low_13
NF1322_low_13
[»] chr8 (1 HSPs)
chr8 (122-301)||(31009848-31010027)


Alignment Details
Target: chr8 (Bit Score: 172; Significance: 3e-92; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 172; E-Value: 3e-92
Query Start/End: Original strand, 122 - 301
Target Start/End: Original strand, 31009848 - 31010027
Alignment:
122 ttattcttttgaaggaataggaatggttttgcctttggaatcagaagcaaaagataaagataaatttggtggagttttgggtttgggaatgtttctaatt 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
31009848 ttattcttttgaaggaataggaatggttttgcctttggaatcagaagcaaaagataaagataaatttggtggagttttgggtttgggaatgttcctaatt 31009947  T
222 tttctgttgtatggaggttttgctactttaggttactttgcttttggtgaagcaactcaagggattattactacaaatct 301  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31009948 tttctattgtatggaggttttgctactttaggttactttgcttttggtgaagcaactcaagggattattactacaaatct 31010027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University