View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1322_low_18 (Length: 318)
Name: NF1322_low_18
Description: NF1322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1322_low_18 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 76 - 318
Target Start/End: Complemental strand, 50395392 - 50395150
Alignment:
| Q |
76 |
gattattctagtgaggatgatgataatgatgtggacaatgacagcgagtttcatttggatgctttcattatggacaggttatccatagatgtgtccaagc |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50395392 |
gattattctagtgaggatgatgataatgatgtggacaatgacagcgagtttgatttggatgctttcattatggacaggttatccatagatgtgtccaagc |
50395293 |
T |
|
| Q |
176 |
tggaagttcaactggaaacgccgaaatttccttctacgaacaaaattttgtctccaagaaggatatggcgaccaagtagtagaactgccaaacaaagtgt |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
50395292 |
tggaagttcaactggaaacgccgaaatttccttctactaacaaaattttgtctccaagaaggatatggcgaccaagtagtagaactgccaaccaaagtgt |
50395193 |
T |
|
| Q |
276 |
aagttcaaaatacaggtaatagttcagggttgagccttgcata |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50395192 |
aagttcaaaatacaggtaatagttcagggttgagccttgcata |
50395150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University