View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1322_low_26 (Length: 289)
Name: NF1322_low_26
Description: NF1322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1322_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 119 - 260
Target Start/End: Complemental strand, 40556840 - 40556699
Alignment:
| Q |
119 |
gagaattatattttgaaacatctttagaacgaatattataactaccgacaattcttttggcttgccaatcttcaaannnnnnncctctaagtcttggaca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40556840 |
gagaattatattttgaaacatctttagaacgaatataataactaccgacaattcttttggcttgccaatcttcaaatttttttcctctaagtcttggaca |
40556741 |
T |
|
| Q |
219 |
acattgaacaaatccaatctctccttctttagaaggtgttat |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40556740 |
acattgaacaaatccaatctctccttctttagaaggtgttat |
40556699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 19 - 88
Target Start/End: Complemental strand, 40556929 - 40556865
Alignment:
| Q |
19 |
aacaaagtttttctaccaatactgaatgaaacaaaacaaagataaagtttctttttattcaaaaaacaaa |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40556929 |
aacaaagtttttctaccaatactgaatgaaacaaa-----gataaagtttctttttattcaaaaaacaaa |
40556865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University