View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1322_low_31 (Length: 266)
Name: NF1322_low_31
Description: NF1322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1322_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 10 - 241
Target Start/End: Original strand, 16067804 - 16068044
Alignment:
| Q |
10 |
aacaatatgtgcaaatttgacttagataggtcgatatttcactagtcaaacccactagctagcatgttttatatattagttcatta---------aagtt |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16067804 |
aacaaaatgtgcaaatttgacttagataggtcgatatttcactagtcaaacccactagctagcatgttttatatattagttcattataaagaattaagtt |
16067903 |
T |
 |
| Q |
101 |
aatctatactctaaccatatgcaattgttagtacttatgatcttattttacttatctctatactctattgattatttattctaattcatagtttgattca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16067904 |
aatctatactctaaccatatgcaattgttagtacttatgatcttattttacttatctctatactctattgattatttattctaattcttagtttgattca |
16068003 |
T |
 |
| Q |
201 |
acttagctctttatttattgtgtcaaatggtcatgcatgtt |
241 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16068004 |
aattagctctttatttattgtgtcaaatggtcatgcatgtt |
16068044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University