View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1322_low_32 (Length: 266)
Name: NF1322_low_32
Description: NF1322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1322_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 241
Target Start/End: Original strand, 16067810 - 16068044
Alignment:
| Q |
16 |
atgtgcaaatttgacttagataggtcgatatttcactagtcaaacccactagctagcatgttttatatattagttcatta---------aagttaatcta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16067810 |
atgtgcaaatttgacttagataggtcgatatttcactagtcaaacccactagctagcatgttttatatattagttcattataaagaattaagttaatcta |
16067909 |
T |
 |
| Q |
107 |
tactctaaccatatgcaattgttagtacttatgatcttattttacttatctctatactctattgattatttattctaattcatagtttgattcaacttag |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
16067910 |
tactctaaccatatgcaattgttagtacttatgatcttattttacttatctctatactctattgattatttattctaattcttagtttgattcaaattag |
16068009 |
T |
 |
| Q |
207 |
ctctttatttattgtgtcaaatggtcatgcatgtt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
16068010 |
ctctttatttattgtgtcaaatggtcatgcatgtt |
16068044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University