View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1322_low_41 (Length: 228)
Name: NF1322_low_41
Description: NF1322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1322_low_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 168
Target Start/End: Complemental strand, 43606689 - 43606523
Alignment:
| Q |
1 |
ctgtcagcttcagtgaatgaggttgtgctggttgtttcaacggtgcatattcaggacagtgtgctgtgttgtctgtcttatttagcttcgtgttttgaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43606689 |
ctgtcagcttcagtgaatgaggttgtgctggttgtttcaacggtgcatattcaggacagtgtgctgtgttgtctgtcttatttagctccgtgttttgaac |
43606590 |
T |
|
| Q |
101 |
cctgtttctcatgcatgtcaaattaggagatacaatttacttggccacaagtccaaacaaagccaacc |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
43606589 |
cctgtttctcatgcatgtcaaattaggagatac-atttacttcgccacaagtccaaacaaagccaacc |
43606523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 222
Target Start/End: Complemental strand, 43606501 - 43606469
Alignment:
| Q |
190 |
ttatatgattcatttgatgtgcctgtaactaat |
222 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
43606501 |
ttatatgattcatttgatgtacctgtaactaat |
43606469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University