View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1322_low_46 (Length: 202)
Name: NF1322_low_46
Description: NF1322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1322_low_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 90 - 164
Target Start/End: Complemental strand, 36059117 - 36059043
Alignment:
| Q |
90 |
attttgtaagctttttaactaaactattcaatttcttcaaaccaatcattttctcaaagtttcttatagaataac |
164 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36059117 |
attttttaagttttttaactaaactattcaatttcttaaaaccaatcattttctcaaagtttcttatagaataac |
36059043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University