View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1322_low_47 (Length: 202)

Name: NF1322_low_47
Description: NF1322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1322_low_47
NF1322_low_47
[»] chr5 (1 HSPs)
chr5 (90-164)||(36059043-36059117)


Alignment Details
Target: chr5 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 90 - 164
Target Start/End: Complemental strand, 36059117 - 36059043
Alignment:
90 attttgtaagctttttaactaaactattcaatttcttcaaaccaatcattttctcaaagtttcttatagaataac 164  Q
    ||||| |||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
36059117 attttttaagttttttaactaaactattcaatttcttaaaaccaatcattttctcaaagtttcttatagaataac 36059043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University