View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13231_high_19 (Length: 302)
Name: NF13231_high_19
Description: NF13231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13231_high_19 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 18 - 302
Target Start/End: Original strand, 50406442 - 50406723
Alignment:
| Q |
18 |
acaaagtctcgtctatataatgattggcagactaacactacctagccaacatcttcttcaacttctgttacaattagtgacacaaaaatggcggttgaag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
50406442 |
acaaagtctcgtctatataatgattggcagactaacactacctagccaacatctt---caacttctgttactattagtgacacaaaaatggcggttgaag |
50406538 |
T |
 |
| Q |
118 |
gtgtaaattcattgaggttatctcaaacaaaaaacctcataatccaagttatcacaggacgatggttcgtggtgtttgcttcttttctaatcatgtcagc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50406539 |
gtgtaaattcattgaggttatctcaaacaaaaaacctcataatccaagttatcacaggacgatggttcgtggtgtttgcttcttttctaatcatgtcagc |
50406638 |
T |
 |
| Q |
218 |
ttcaggagccacctacatgtttggtctttactctagtaccataaaaacatccttagcctatgaccaaacaactcttaacctcctt |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50406639 |
ttcaggagccacctacatgtttggtctttactctagtaccataaaaacatccttagcctatgaccaaacaactcttaacctcctt |
50406723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 160 - 250
Target Start/End: Original strand, 50389694 - 50389784
Alignment:
| Q |
160 |
tccaagttatcacaggacgatggttcgtggtgtttgcttcttttctaatcatgtcagcttcaggagccacctacatgtttggtctttactc |
250 |
Q |
| |
|
||||||| ||||| ||||| ||||| || | ||||| || |||||||||||||| ||| | ||||||||||||||||| ||||| ||||| |
|
|
| T |
50389694 |
tccaagtcatcaccggacggtggtttgtcatttttgcctcctttctaatcatgtcggctgccggagccacctacatgttcggtctatactc |
50389784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 168 - 250
Target Start/End: Original strand, 50392976 - 50393058
Alignment:
| Q |
168 |
atcacaggacgatggttcgtggtgtttgcttcttttctaatcatgtcagcttcaggagccacctacatgtttggtctttactc |
250 |
Q |
| |
|
||||| ||||| |||||||| | ||||| || ||||| |||||| |||| | ||||||||||||||||||||||| ||||| |
|
|
| T |
50392976 |
atcaccggacggtggttcgtcatttttgcctcctttcttatcatggcagcagccggagccacctacatgtttggtctatactc |
50393058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University