View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13231_low_25 (Length: 236)
Name: NF13231_low_25
Description: NF13231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13231_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 222
Target Start/End: Complemental strand, 3420528 - 3420325
Alignment:
| Q |
19 |
ctccttggaggaagaaccggtacatgcaaaacaagtggtttggaccttatcgtaggaccacgaacccggttcatggaaatccggttccagatgttgtttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3420528 |
ctccttggaggaagaaccggtacatgcaaaacaagtggtttggaccttatcgtaggaccacgaacccggttcatggaaatccggttccagatgttgtttc |
3420429 |
T |
 |
| Q |
119 |
ttctttcagtggcgttaaatgcagattagtcgggttcgacaacgccatgtccgagatcaaacatggcgtcgcctttgtcagaatcaaatgattgatagta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3420428 |
ttctttcagtggcgttaaatgcagattagtcgggttcgacaacgccatgtccgagatcaaacatggcgtcgcctttgtcagaatcaaatgattgatagta |
3420329 |
T |
 |
| Q |
219 |
gtat |
222 |
Q |
| |
|
|||| |
|
|
| T |
3420328 |
gtat |
3420325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 64
Target Start/End: Complemental strand, 18757742 - 18757702
Alignment:
| Q |
24 |
tggaggaagaaccggtacatgcaaaacaagtggtttggacc |
64 |
Q |
| |
|
|||||||||||||||| |||||| || |||||||||||||| |
|
|
| T |
18757742 |
tggaggaagaaccggttcatgcagaataagtggtttggacc |
18757702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University