View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13231_low_26 (Length: 233)
Name: NF13231_low_26
Description: NF13231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13231_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 14 - 216
Target Start/End: Original strand, 32989405 - 32989607
Alignment:
| Q |
14 |
ataattctaacaggaaaaccatgatctggtgttaaaacgtcaccgttttgcatatatgcaagaatgatatcacgggaaggatccaatgcaacctcccttg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32989405 |
ataattctaacaggaaaaccatgatctggtgttaaaacgtcaccgttttgcatatatgcaagaatgatatcacgggaaggatccaatgcaacctcccttg |
32989504 |
T |
 |
| Q |
114 |
tgatactagttccatatttggatccaccaccacctggcagttcctcagcaccttcaaaacatacatagagggccccactgttacggttcaagatgccaca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32989505 |
tgatactagttccatatttggatccaccaccacctggaagttcctcagcaccttcaaaacatacatagagggccccactgttacggttcaagatgccaca |
32989604 |
T |
 |
| Q |
214 |
act |
216 |
Q |
| |
|
||| |
|
|
| T |
32989605 |
act |
32989607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 23 - 215
Target Start/End: Original strand, 32961751 - 32961943
Alignment:
| Q |
23 |
acaggaaaaccatgatctggtgttaaaacgtcaccgttttgcatatatgcaagaatgatatcacgggaaggatccaatgcaacctcccttgtgatactag |
122 |
Q |
| |
|
||||||||||| ||||| || | |||||| ||||| ||||||||||| || | ||||||||| | | |||||||||||||||| || |||||||| |
|
|
| T |
32961751 |
acaggaaaaccgtgatcaggagctaaaacctcaccattttgcatatacgccaaaatgatatcgctagtgcgatccaatgcaacctcgctgaggatactag |
32961850 |
T |
 |
| Q |
123 |
ttccatatttggatccaccaccacctggcagttcctcagcaccttcaaaacatacatagagggccccactgttacggttcaagatgccacaac |
215 |
Q |
| |
|
|||||||||| || |||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |||||||| || || ||||||| |
|
|
| T |
32961851 |
ttccatattttgaaccaccaccacctggaagttcctcagcaccttcaaagcatacatagagggccccacttttacggttaaatattccacaac |
32961943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University