View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13232_low_2 (Length: 535)
Name: NF13232_low_2
Description: NF13232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13232_low_2 |
 |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 303; Significance: 1e-170; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 11 - 486
Target Start/End: Complemental strand, 12487914 - 12487433
Alignment:
| Q |
11 |
catcaaatatgtaaaaatatctgtacagtaattcagtaatataaatataagaggagtgtttacaacagtttctttttaacgatcattcaaacactctttt |
110 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| || |
|
|
| T |
12487914 |
catcaaatctgtaaaaatatctgtacagtaattcaggaatataaatataagaggagtgcttacaacagtctctttttaacgatcattcaaacactctctt |
12487815 |
T |
 |
| Q |
111 |
ttattgagtaaaattaacgtggttattatacttttaaaatggtatccatataagtagtgggagacac--atattttacgcaattaaaaaggaagtgtttg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| ||||| |||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12487814 |
ttattgagtaaaattaacgtggttattatactttaaaaatgggatccacataagtggtgggagacacatatattttacgcaattaaaaaggaagtgtttg |
12487715 |
T |
 |
| Q |
209 |
agtgagagtgttgaaattgacacctttgctaatacttctaatataaatattggttcaaattttaaaatatacttggactttcaacaacaacaaaaattaa |
308 |
Q |
| |
|
||| ||||||||||| ||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| | |
|
|
| T |
12487714 |
agt--gagtgttgaaa-tgacacctttgctaatacttcaaatataaatattggttgaaattttaaaatatacttggactttcaacaac-acaaaaa--ag |
12487621 |
T |
 |
| Q |
309 |
tacattgtgtgttttgtttaaaagaaattagtacattgtgttgttac---------tacaaaagatgtattttttgtgttaagtgtagattctctgcaac |
399 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12487620 |
tgcattgtgtgttttgtttaaaagaaattagtacattgtgttgttactacaaaagatacaaaagatgtattttttgtgttaagtgtagattctctggaac |
12487521 |
T |
 |
| Q |
400 |
acaattgcatagacgggtccttcg-atctgatagaatcacagtagattaatnnnnnnnntgtatttcatatacatatattaatattta |
486 |
Q |
| |
|
||||||||||||| |||||||||| ||| |||||||||||| |||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
12487520 |
acaattgcatagatgggtccttcgaatccgatagaatcacaatagattgataaaaaaaatgtatttcatatacatatattaatattta |
12487433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 474 - 518
Target Start/End: Complemental strand, 1105161 - 1105117
Alignment:
| Q |
474 |
atattaatatttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
1105161 |
atattaaactttaggctaaaatatggttttggtccctgcaaatat |
1105117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 482 - 518
Target Start/End: Original strand, 32108803 - 32108839
Alignment:
| Q |
482 |
atttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
32108803 |
atttaggctaaaatatggttttggtccctgcaaatat |
32108839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 490 - 518
Target Start/End: Original strand, 35609306 - 35609334
Alignment:
| Q |
490 |
taaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35609306 |
taaaatatggttttggtccatgcaaatat |
35609334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000008; HSPs: 9)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 473 - 518
Target Start/End: Original strand, 31846972 - 31847017
Alignment:
| Q |
473 |
tatattaatatttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
31846972 |
tatattaatttttaggttaaaatatgcttttggtccctgcaaatat |
31847017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 483 - 518
Target Start/End: Original strand, 23676128 - 23676163
Alignment:
| Q |
483 |
tttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23676128 |
tttaggttaaaatatggttttggtccctgcaaatat |
23676163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 485 - 518
Target Start/End: Original strand, 45671212 - 45671245
Alignment:
| Q |
485 |
taggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
45671212 |
taggttaaaatatggttttagtccatgcaaatat |
45671245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 482 - 518
Target Start/End: Complemental strand, 3975843 - 3975807
Alignment:
| Q |
482 |
atttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
3975843 |
atttaggctaaaatatggttttggtccctgcaaatat |
3975807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 486 - 518
Target Start/End: Complemental strand, 6589275 - 6589243
Alignment:
| Q |
486 |
aggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
6589275 |
aggttaaaatatggttttggtccctgcaaatat |
6589243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 490 - 518
Target Start/End: Complemental strand, 30223792 - 30223764
Alignment:
| Q |
490 |
taaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30223792 |
taaaatatggttttggtccatgcaaatat |
30223764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 486 - 518
Target Start/End: Original strand, 38186365 - 38186397
Alignment:
| Q |
486 |
aggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
38186365 |
aggttaaaatatggttttggtccctgcaaatat |
38186397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 486 - 518
Target Start/End: Complemental strand, 39520731 - 39520699
Alignment:
| Q |
486 |
aggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
39520731 |
aggttaaaatatggttttggtccttgcaaatat |
39520699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 486 - 518
Target Start/End: Original strand, 48192256 - 48192288
Alignment:
| Q |
486 |
aggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
48192256 |
aggttaaaatatggttttggtccctgcaaatat |
48192288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000003; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 474 - 518
Target Start/End: Complemental strand, 3512279 - 3512235
Alignment:
| Q |
474 |
atattaatatttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
3512279 |
atattaaaatttaggctaaaatatggttttggtccctgcaaatat |
3512235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 482 - 518
Target Start/End: Complemental strand, 11976741 - 11976705
Alignment:
| Q |
482 |
atttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11976741 |
atttaggttaaaatatggttttggtccctgcaaatat |
11976705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 472 - 518
Target Start/End: Complemental strand, 28346772 - 28346727
Alignment:
| Q |
472 |
atatattaatatttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
28346772 |
atatattaat-tttaggctaaaatatggttttggtccctgcaaatat |
28346727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 477 - 518
Target Start/End: Original strand, 10337109 - 10337150
Alignment:
| Q |
477 |
ttaatatttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||| |||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
10337109 |
ttaatttttaggctaaaatatggttttggtccctgcaaatat |
10337150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000003; HSPs: 8)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 482 - 518
Target Start/End: Complemental strand, 51738416 - 51738380
Alignment:
| Q |
482 |
atttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
51738416 |
atttaggctaaaatatggttttggtccatgcaaatat |
51738380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 480 - 518
Target Start/End: Original strand, 20144413 - 20144451
Alignment:
| Q |
480 |
atatttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
20144413 |
atatttacgttaaaatatggttttggtccctgcaaatat |
20144451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 485 - 518
Target Start/End: Original strand, 30060767 - 30060800
Alignment:
| Q |
485 |
taggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
30060767 |
taggttaaaatatggttttggtccctgcaaatat |
30060800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 485 - 518
Target Start/End: Complemental strand, 30091116 - 30091083
Alignment:
| Q |
485 |
taggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
30091116 |
taggctaaaatatggttttggtccatgcaaatat |
30091083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 482 - 518
Target Start/End: Complemental strand, 14488192 - 14488156
Alignment:
| Q |
482 |
atttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
14488192 |
atttaggctaaaatatggttttggtccctgcaaatat |
14488156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 486 - 518
Target Start/End: Complemental strand, 29499547 - 29499515
Alignment:
| Q |
486 |
aggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
29499547 |
aggttaaaatatggttttggtccctgcaaatat |
29499515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 486 - 518
Target Start/End: Original strand, 50753921 - 50753953
Alignment:
| Q |
486 |
aggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
50753921 |
aggttaaaatatggttttggtccctgcaaatat |
50753953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 486 - 518
Target Start/End: Complemental strand, 54208826 - 54208794
Alignment:
| Q |
486 |
aggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
54208826 |
aggttaaaatatggttttggtccctgcaaatat |
54208794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.00000001; HSPs: 8)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 483 - 518
Target Start/End: Original strand, 1721085 - 1721120
Alignment:
| Q |
483 |
tttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1721085 |
tttaggttaaaatatggttttggtccttgcaaatat |
1721120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 487 - 518
Target Start/End: Complemental strand, 8555308 - 8555277
Alignment:
| Q |
487 |
ggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8555308 |
ggttaaaatatggttttggtccatgcaaatat |
8555277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 486 - 518
Target Start/End: Complemental strand, 863653 - 863621
Alignment:
| Q |
486 |
aggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
863653 |
aggttaaaatatggttttggtccctgcaaatat |
863621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 478 - 518
Target Start/End: Complemental strand, 3830525 - 3830485
Alignment:
| Q |
478 |
taatatttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||||||| |||||||||||||| |||| ||||||||| |
|
|
| T |
3830525 |
taatatttaggctaaaatatggttttagtccctgcaaatat |
3830485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 486 - 518
Target Start/End: Complemental strand, 8940526 - 8940494
Alignment:
| Q |
486 |
aggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
8940526 |
aggttaaaatatggttttggtccctgcaaatat |
8940494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 478 - 518
Target Start/End: Original strand, 28552012 - 28552052
Alignment:
| Q |
478 |
taatatttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
|||||| |||| ||||||||||||||||||| ||||||||| |
|
|
| T |
28552012 |
taatatctaggctaaaatatggttttggtccctgcaaatat |
28552052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 486 - 518
Target Start/End: Complemental strand, 35569137 - 35569105
Alignment:
| Q |
486 |
aggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
35569137 |
aggttaaaatatggttttggtccctgcaaatat |
35569105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 483 - 519
Target Start/End: Complemental strand, 47005523 - 47005487
Alignment:
| Q |
483 |
tttaggttaaaatatggttttggtccatgcaaatatt |
519 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
47005523 |
tttaggctaaaatatggttttggtccctgcaaatatt |
47005487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.00000001; HSPs: 7)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 483 - 518
Target Start/End: Complemental strand, 3247566 - 3247531
Alignment:
| Q |
483 |
tttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3247566 |
tttaggttaaaatatggttttggtccctgcaaatat |
3247531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 478 - 518
Target Start/End: Original strand, 10887224 - 10887264
Alignment:
| Q |
478 |
taatatttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
|||| |||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
10887224 |
taatttttaggctaaaatatggttttggtccctgcaaatat |
10887264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 478 - 518
Target Start/End: Original strand, 33067339 - 33067379
Alignment:
| Q |
478 |
taatatttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||||||| |||||||||||||| |||| ||||||||| |
|
|
| T |
33067339 |
taatatttaggctaaaatatggttttagtccttgcaaatat |
33067379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 486 - 518
Target Start/End: Original strand, 38150847 - 38150879
Alignment:
| Q |
486 |
aggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
38150847 |
aggttaaaatatggttttggtccctgcaaatat |
38150879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 486 - 518
Target Start/End: Original strand, 38163930 - 38163962
Alignment:
| Q |
486 |
aggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
38163930 |
aggttaaaatatggttttggtccctgcaaatat |
38163962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 486 - 518
Target Start/End: Original strand, 39025108 - 39025140
Alignment:
| Q |
486 |
aggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
39025108 |
aggttaaaatatggttttggtccctgcaaatat |
39025140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 482 - 518
Target Start/End: Original strand, 45380267 - 45380303
Alignment:
| Q |
482 |
atttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
45380267 |
atttaggctaaaatatggttttggtccctgcaaatat |
45380303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 476 - 518
Target Start/End: Complemental strand, 27375 - 27333
Alignment:
| Q |
476 |
attaatatttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
27375 |
attaaaatttaggctaaaatatggttttggtccctgcaaatat |
27333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000005; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 484 - 518
Target Start/End: Original strand, 15842458 - 15842492
Alignment:
| Q |
484 |
ttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15842458 |
ttaggttaaaatatggttttggtccctgcaaatat |
15842492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 485 - 518
Target Start/End: Complemental strand, 3832639 - 3832606
Alignment:
| Q |
485 |
taggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
3832639 |
taggttaaaatatggttttggtccctgcaaatat |
3832606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 477 - 518
Target Start/End: Complemental strand, 15842833 - 15842792
Alignment:
| Q |
477 |
ttaatatttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||| ||||||||| |
|
|
| T |
15842833 |
ttaatattaaggctaaaatatggttttggtccctgcaaatat |
15842792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 490 - 518
Target Start/End: Complemental strand, 36815832 - 36815804
Alignment:
| Q |
490 |
taaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36815832 |
taaaatatggttttggtccatgcaaatat |
36815804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 477 - 518
Target Start/End: Complemental strand, 75774 - 75733
Alignment:
| Q |
477 |
ttaatatttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
75774 |
ttaaaatttaggctaaaatatggttttggtccctgcaaatat |
75733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000002; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 481 - 518
Target Start/End: Complemental strand, 21994409 - 21994372
Alignment:
| Q |
481 |
tatttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
21994409 |
tatttaggctaaaatatggttttggtccctgcaaatat |
21994372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 482 - 518
Target Start/End: Original strand, 12298817 - 12298853
Alignment:
| Q |
482 |
atttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
12298817 |
attttggttaaaatatggttttggtccctgcaaatat |
12298853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 482 - 518
Target Start/End: Complemental strand, 22543723 - 22543687
Alignment:
| Q |
482 |
atttaggttaaaatatggttttggtccatgcaaatat |
518 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
22543723 |
atttaggctaaaatatggttttggtccctgcaaatat |
22543687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University