View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13232_low_9 (Length: 244)
Name: NF13232_low_9
Description: NF13232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13232_low_9 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 244
Target Start/End: Complemental strand, 44905245 - 44905019
Alignment:
| Q |
18 |
agaaacaccatcaaaaggcttaagatatttagttttctgcatctatatcgtttaggttgagagnnnnnnnggttttaaaagtcctgtcattcaataacat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| ||| ||||||| |
|
|
| T |
44905245 |
agaaacaccatcaaaaggcttaagatatttagtttgctgcatctatatcgtttaggttgagagaaaaaaaggttttaaaagtcctgtcgttcgataacat |
44905146 |
T |
 |
| Q |
118 |
tgcaaaatcattagattggcattatgttttgttagtgttttgctgatgctgttagccctcaattgtgtgtgaactctgttctggacccaatggaggacat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44905145 |
tgcaaaatcattagattggcattatgttttgttagtgttttgctgatgctgttagccctcaattgcgtgtgaactctgttctggacccaatggaggacat |
44905046 |
T |
 |
| Q |
218 |
cagtttcatttgatatcagcatttact |
244 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
44905045 |
cagtttcatttgatatcagcatttact |
44905019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University