View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13233_low_12 (Length: 250)

Name: NF13233_low_12
Description: NF13233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13233_low_12
NF13233_low_12
[»] chr1 (1 HSPs)
chr1 (134-233)||(28850309-28850408)


Alignment Details
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 134 - 233
Target Start/End: Complemental strand, 28850408 - 28850309
Alignment:
134 aatttcctcaagcctaacccacccaaccacttcggttttgagacaacatcccacttcactgcatgtaaatgacggcactgttcatcatcaccccaaataa 233  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||    
28850408 aatttcctcaagcctaacccacccaaccacttcggttttcagacaacatcccacttcactgcatgtaaatgtcggcgctgttcatcctcaccccaaataa 28850309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University