View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13233_low_13 (Length: 243)
Name: NF13233_low_13
Description: NF13233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13233_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 83 - 228
Target Start/End: Complemental strand, 51011277 - 51011132
Alignment:
| Q |
83 |
aatgttttgaaggtatattatatttacctcaactttaaaaacatttgagacaagacccttatgactggttactgtggcatgcattacatccatgcctaaa |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51011277 |
aatgttttgaaggtatattatatttacctcaactttaaaaacatttgagacaagacccttatgactggttactgtggcatgcattacatccatgcctaaa |
51011178 |
T |
 |
| Q |
183 |
gtgttgaaagcatccatcaatttcacaaaaccaccaggcctatgct |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51011177 |
gtgttgaaagcatccatcaatttcacaaaaccaccaggcctatgct |
51011132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University