View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13234_high_2 (Length: 648)
Name: NF13234_high_2
Description: NF13234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13234_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 594; Significance: 0; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 594; E-Value: 0
Query Start/End: Original strand, 1 - 638
Target Start/End: Complemental strand, 34867457 - 34866820
Alignment:
| Q |
1 |
ttgatgtttggaatggagataggaaactggctaaaaagatatggagaagattttgagattgttaaggggagaacaaactggtggtggctcatggtggttt |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34867457 |
ttgatgtttggaatggagatgggaaactggctaaaaagatatggagaagattttgagattgttaagggtagaacaaactggtggtggctcatggtggttt |
34867358 |
T |
 |
| Q |
101 |
gtggtagtagatttagatccggacttggtagttgggttcggatctagatccgaatctttggtagctgctgagaaagatatggcatggtttctctttgaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34867357 |
gtggtagtagatttagatccggacttggtagttgggttcggatctagatccgaatctttggtagctgctgagaaagatatggcatggtttctctttgaga |
34867258 |
T |
 |
| Q |
201 |
ttatcttctatctctttctttacgtggcttattacacaaaactccattaattttcattttgaattttatgggttaagatatggcatgtttatccacttct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34867257 |
ttatcttctatctctttctttacgtggcttgttacacaaaactccattaattttcattttgaattttatgggttaagatatggcatggttatccacttct |
34867158 |
T |
 |
| Q |
301 |
gtgataatatttttgaagccgtgaggactctttgcttgtagtatttttattgtgagtcattatagtcatcactcttcaaaattgttgcttaagtggcatt |
400 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34867157 |
gtgatgatatttttgaagccgtgaggactctttgcttgtagtatttttattgtgagtcattatagtcatcactcttcaaaattgttgcttaagtggcatt |
34867058 |
T |
 |
| Q |
401 |
gtgcatgctaaccagctgccatggaaatgccttatgtgtttcaagaagcttctggaggtcaacgaaaaaacaaatctggtgtctagagttccttggaact |
500 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34867057 |
atgcatgctaaccggctgccatggaaatgccttatgtgtttcaagaagcttctggaggtcaacgaaaaaacagatctggtgtctagagttccttggaact |
34866958 |
T |
 |
| Q |
501 |
agtttgtcagatttggtttgtcggataattgtggtggttcagcttttaatggattttaagagtggttcatgggttggattgcggtgctttggggtgagct |
600 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34866957 |
agttagtcagatttggtttgtcggataattgtggtggttcagcttttaatggattttaagagtggttcatggattggattgcggtgctttggggtgagct |
34866858 |
T |
 |
| Q |
601 |
tttgggtggtagtttaggttgtgtggtggtgatgatgt |
638 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34866857 |
tttgggtggtagtttaggttgtgtggtggtggtgatgt |
34866820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 5 - 76
Target Start/End: Complemental strand, 34874852 - 34874782
Alignment:
| Q |
5 |
tgtttggaatggagataggaaactggctaaaaagatatggagaagattttgagattgttaaggggagaacaa |
76 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||| ||||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
34874852 |
tgtttggaatggagataggaaactagctgaaa-gatatggggaagattttgagatagttaagggcagaacaa |
34874782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University