View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13234_low_13 (Length: 234)
Name: NF13234_low_13
Description: NF13234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13234_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 24 - 208
Target Start/End: Complemental strand, 3914958 - 3914773
Alignment:
| Q |
24 |
ttaagaacattgtgaaattttgtttcagactatggtggattgatatacatggaggacctcttattatttgttttttaag-nnnnnnnnnnttctagtgag |
122 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3914958 |
ttaagaacattgcgaaattatgtttcagactatggtggattgatatacatggaggacctcttattatttgttttttaagaaaaaaaaaaattctagtgag |
3914859 |
T |
|
| Q |
123 |
atcctgtnnnnnnnnttgataaaaagatatataaaatatgagcaagattacccatgtggcttcttgatttaattttaaattagacc |
208 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3914858 |
atcctgtaaaaaaaattgataaaaagatatagaaaatatgagcaagattacccatgtggcttcttgatttaattttaaattagacc |
3914773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University