View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13235_high_13 (Length: 269)
Name: NF13235_high_13
Description: NF13235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13235_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 7 - 114
Target Start/End: Original strand, 9502371 - 9502478
Alignment:
| Q |
7 |
tagataatactttaataatacatacaatattacaactgatgcatttagcactataaccaccaattccttaagccagagcaaagaaacaaaatcaaacaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9502371 |
tagataatactttaataatacatacaatattacaactgatgcatttagcactataaccaccaattccttaagccagagcaaagaaacaaaatcaaacaat |
9502470 |
T |
 |
| Q |
107 |
ctgatatt |
114 |
Q |
| |
|
|||||||| |
|
|
| T |
9502471 |
ctgatatt |
9502478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University