View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13235_low_9 (Length: 343)
Name: NF13235_low_9
Description: NF13235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13235_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 24 - 329
Target Start/End: Complemental strand, 54472393 - 54472088
Alignment:
| Q |
24 |
taattaacttcctccattaactattctaaacttcataacatgcttatttgcaaattcctattnnnnnnngaaataggagatatataaaaatatataccgt |
123 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
54472393 |
taattagcttcccccattaactattctaaacttcataacatgcttatttgcaaattcctattaaaaaaagaaataggagatatataaaaatatataccgt |
54472294 |
T |
 |
| Q |
124 |
gtgctggagtagggtagtaatgaatgtgatgaggttgtgatctcttcttccttcttgtacatataacgcagagtaggataatgacaaggaggattataca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54472293 |
gtgctggagtagggtagtaatgaatgtgatgaggttgtgatctcttcttccttcttgtacatataacgcagagtaggataatgacaaggaggattataca |
54472194 |
T |
 |
| Q |
224 |
agctgcacctgcaactgctattataccacccacgctcaattgattcccattgttatcatttgtattgttgccgttgttcgagggtgatgatttatgatga |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54472193 |
agctgcacctgcaactgctattataccacccacgctcaattgattcccattgttatcatttgtattgttgccgttgttcgagggtgatgatttatgatga |
54472094 |
T |
 |
| Q |
324 |
tgatgt |
329 |
Q |
| |
|
|||||| |
|
|
| T |
54472093 |
tgatgt |
54472088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University