View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13236_low_2 (Length: 610)
Name: NF13236_low_2
Description: NF13236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13236_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 568; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 568; E-Value: 0
Query Start/End: Original strand, 1 - 605
Target Start/End: Complemental strand, 5684859 - 5684255
Alignment:
| Q |
1 |
tatcatcctgtaatgtctctgatggttcaagtgagtatccaagggcttgtttcgcttcgagtaaatactcatcgatccataatttatcggcattgttaag |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5684859 |
tatcatcctctaatgtctctgatggttcaagtgagtatccaagggcttgtttcgcttcgagtaaatactcatcgatccataatttatcggcattgttaag |
5684760 |
T |
 |
| Q |
101 |
gcgcgatgaaggtagacaagaacttaacaatgggaatgattttagtgaaagttgtggactgttgagaaatctttctgcgagttttttatcgtctagtggg |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5684759 |
gcgcaatgaaggtagacaagaacttaacaatgggaatgattttagtgaaagttgtggactgttgagaaatctttctgcgagttttttatcgtctagtggg |
5684660 |
T |
 |
| Q |
201 |
ggttttaaaatgtaacgtcttggtggtgattttgattttgggttagtgannnnnnngcgttctgctagttcttttagaagtcgttgaggattgttatttc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5684659 |
ggttttaaaatgtaacgtcttggtggtgattttgattttgggttagtgatttttttgcgttctgctagttcttttagaagtcgttgaggattgttatttc |
5684560 |
T |
 |
| Q |
301 |
tagggaagtcttttgttgggtctattgcaactgcgagaacgtgaagagggtagtttcgggatttggtgtttttgattaggatttggatggggaaaggaga |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5684559 |
tagggaagtcttttgttgggtctattgcaactgcgagaacgtgaagagggtagtttcgggatttggtgtttttgattaggatttggatggggaaaggaga |
5684460 |
T |
 |
| Q |
401 |
gaatgaggatgagaatgagaagttagttggttttggggagagtgaaaaagaggatgagagttccattgttgttgtttgaaggggattgaattgtgatggg |
500 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5684459 |
gaatgaggatgagaatgagaagttagttggttttggggagagtgaaaaagaggatgagagttccattgttgttgtttgaaggggattgaattgtgatggg |
5684360 |
T |
 |
| Q |
501 |
aaatgtagatagtggaaaattggagggtttgtgaagattaatgggattgatttgtggatttttgtattggttttgacattgtagatgaagggggtctgtg |
600 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5684359 |
aaatgtagatagtggaaaattggagggtttgtgaagattaatgggattgatttgtggatttttgtattggttttgacattgtagatgaagggggtttgtg |
5684260 |
T |
 |
| Q |
601 |
ctgct |
605 |
Q |
| |
|
|||| |
|
|
| T |
5684259 |
ttgct |
5684255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University