View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13237_high_31 (Length: 281)
Name: NF13237_high_31
Description: NF13237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13237_high_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 9500071 - 9500329
Alignment:
| Q |
1 |
gtgtaatttaaactctaccgccccctgtttttgcattcttttacgtcctctgttttacttgaagccctcttctattatgnnnnnnnnnnnnnnnnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9500071 |
gtgtaatttaaactctaccgccccctgtttt-gcattcttttactacctctgttttacttgaagccctcttctattatgttttttctattcttttttctt |
9500169 |
T |
|
| Q |
101 |
ncttatatatgttgtgtagtttgtacttggtagacctgtcgtattgatttaacattatgccttcaattttgtttcttcaatttttgagcatttatatgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
9500170 |
tcttatatatgttgtgtagtttgtacttggtagccctgtcgtattgatttaacattacgccttcaaatttttttcttcaatttttgagcatttatatgca |
9500269 |
T |
|
| Q |
201 |
tgtattataagttactcgagttgtctgcataagcttcagttgacatatcaattatcaaaa |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9500270 |
tgtattataagttactcgagttgtctgcataagcttcagttgacatatcaattatcaaaa |
9500329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University