View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13237_high_37 (Length: 239)
Name: NF13237_high_37
Description: NF13237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13237_high_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 14 - 222
Target Start/End: Original strand, 31530291 - 31530499
Alignment:
| Q |
14 |
atatatagggtctcagctgaatcaacaagctagctgaccaaaatttttgggtgacacaaactctttccctcctgtaaacagagtcacagcagccaactct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31530291 |
atatatagggtctcagctgaatcaacaagctagctgaccaaaatttttgggtgacacaaactctttccctcctgtaaacagagtcacagcagccaactct |
31530390 |
T |
 |
| Q |
114 |
gaagctttctcagttggatgaaaccaatcccaaaacaagaaatcatcacgattcttgcaaagatttgcgttaagagattttaagcatggaccttctccat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31530391 |
gaagctttctcagttggatgaaaccaatcccaaaacaagaaatcatcacgattcttgcaaagatttgcgttaagagatttcaagcatggaccttctccat |
31530490 |
T |
 |
| Q |
214 |
tgaactttc |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
31530491 |
tgaactttc |
31530499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University