View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13237_high_39 (Length: 231)

Name: NF13237_high_39
Description: NF13237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13237_high_39
NF13237_high_39
[»] chr8 (1 HSPs)
chr8 (12-203)||(42227577-42227768)


Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 12 - 203
Target Start/End: Complemental strand, 42227768 - 42227577
Alignment:
12 gagaagcaaagggaagttgtgactgagggagctatacaaatatgagttattttcgataagcaaactttttattaaagggagcacaagagatattcgaact 111  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||    
42227768 gagaaacaaagggaagttgtgactgagggagctatacaaatatgagttattttcgataagcaaactttttaataaagggagtacaagagatattcgaact 42227669  T
112 catacaacaaaattagtttggacccaacatcatagcatgaaaatagtactcatcttctataaagggttgccaaatcatatgctcaaaagtca 203  Q
    ||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||    
42227668 catacaacaaaattagtttggacccaacatcatagcaggaaaattgtactcatcttctataaagggttgccaaatcatatgctcaaaagtca 42227577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University