View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13237_high_39 (Length: 231)
Name: NF13237_high_39
Description: NF13237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13237_high_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 12 - 203
Target Start/End: Complemental strand, 42227768 - 42227577
Alignment:
| Q |
12 |
gagaagcaaagggaagttgtgactgagggagctatacaaatatgagttattttcgataagcaaactttttattaaagggagcacaagagatattcgaact |
111 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
42227768 |
gagaaacaaagggaagttgtgactgagggagctatacaaatatgagttattttcgataagcaaactttttaataaagggagtacaagagatattcgaact |
42227669 |
T |
 |
| Q |
112 |
catacaacaaaattagtttggacccaacatcatagcatgaaaatagtactcatcttctataaagggttgccaaatcatatgctcaaaagtca |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42227668 |
catacaacaaaattagtttggacccaacatcatagcaggaaaattgtactcatcttctataaagggttgccaaatcatatgctcaaaagtca |
42227577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University