View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13237_low_14 (Length: 391)
Name: NF13237_low_14
Description: NF13237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13237_low_14 |
 |  |
|
| [»] scaffold0034 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0034 (Bit Score: 168; Significance: 6e-90; HSPs: 1)
Name: scaffold0034
Description:
Target: scaffold0034; HSP #1
Raw Score: 168; E-Value: 6e-90
Query Start/End: Original strand, 118 - 301
Target Start/End: Complemental strand, 109003 - 108820
Alignment:
| Q |
118 |
ttgatggtgatttgctttcagttgttggtggtagctttgataccaaacgttgtttcagcgacggtgaaggagagtcacaatctgggtcagcgcttgttgt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
109003 |
ttgatggtgatttgctttcagttgttggtggtagcttcgataccaaacgttgtttcagcgatggtgaaggagagtcacaatctgggtcagcgtttgttgt |
108904 |
T |
 |
| Q |
218 |
ttcaaaaccgggtcttggtgcgaggatatgaggttctatgtgagaggatgagaagtcacgatctgggtcagcgcttgttcttct |
301 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
108903 |
ttcaaaaccgtgtcttggtgcgaggatatgaggttctatgtgagaggatgagaagtcacgatctgggtcagcgcttgttcttct |
108820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 160; Significance: 4e-85; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 118 - 301
Target Start/End: Complemental strand, 3209176 - 3208994
Alignment:
| Q |
118 |
ttgatggtgatttgctttcagttgttggtggtagctttgataccaaacgttgtttcagcgacggtgaaggagagtcacaatctgggtcagcgcttgttgt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3209176 |
ttgatggtgatttgctttcagttgttggtggtagcttcgataccaaacgttgtt-cagcgacggtgaaggagagtcacaatctgggtcagcgcttattgt |
3209078 |
T |
 |
| Q |
218 |
ttcaaaaccgggtcttggtgcgaggatatgaggttctatgtgagaggatgagaagtcacgatctgggtcagcgcttgttcttct |
301 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3209077 |
ttcaaaactgtgtcttggtgcgaggatatgaggttctatgtgagaggatgagaagtcacgatctgggtcagcgcttgttcttct |
3208994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 10280776 - 10280641
Alignment:
| Q |
1 |
ttcggtgttcttccagtatacaaacctcagtagcatcctaaccttctctgatggtcttatatagcactatcgaatctaaggtccgccaagggttacaaag |
100 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||| |||||||||| | |||| |||| ||||||||| | |||||||| ||| |
|
|
| T |
10280776 |
ttcggtgttcttccgacgtacaagtctcagtagcatcctaaccttctctggtggtcttatagatcactgtcgactctaaggtcagtcaagggttgtgaag |
10280677 |
T |
 |
| Q |
101 |
tggagttgtttcgttggttgatggtgatttgctttca |
137 |
Q |
| |
|
||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
10280676 |
tggcgttgtttcgttggttgatggt-atttgctttca |
10280641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 104; Significance: 9e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 3 - 138
Target Start/End: Complemental strand, 5536005 - 5535871
Alignment:
| Q |
3 |
cggtgttcttccagtatacaaacctcagtagcatcctaaccttctctgatggtcttatatagcactatcgaatctaaggtccgccaagggttacaaagtg |
102 |
Q |
| |
|
|||||||||||| | |||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5536005 |
cggtgttcttccggcatacaagcctcagtagcatcctaaccttctctggtggtcttatatagcactgtcgaatctaaggtccgccaagggttacaaagtg |
5535906 |
T |
 |
| Q |
103 |
gagttgtttcgttggttgatggtgatttgctttcag |
138 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||| |
|
|
| T |
5535905 |
gagttgtttcgttggttggtggt-atttgctttcag |
5535871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 118 - 154
Target Start/End: Original strand, 31283338 - 31283374
Alignment:
| Q |
118 |
ttgatggtgatttgctttcagttgttggtggtagctt |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31283338 |
ttgatggtgatttgctttcagttgttggtggtagctt |
31283374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University