View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13237_low_20 (Length: 339)
Name: NF13237_low_20
Description: NF13237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13237_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 11 - 229
Target Start/End: Original strand, 41341970 - 41342187
Alignment:
| Q |
11 |
agcagaacctgtgaatttattacatctttcaacattactgtattgaaccaaccaattagttcaaagagagaaaataaaaatattaaattacagcaccaga |
110 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41341970 |
agcagcacctgtgattttattacatctttcaacattactgtattgaaccaaacaattagttcaaagagagaaaataaaaatattaaattacagcaccaga |
41342069 |
T |
|
| Q |
111 |
agatggtcccatgtaacttgctgacctcttgaattgcaggtaaaaacttcttggcaggttgaaatggaacttcattgccctgaaaattaacatcaaatat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41342070 |
agatggtcccatgtaacttgctgacctcttgaattgcaggtaaaaacttcttggcaggttgaaatggaacttcattgccctgaaaattaacatc-aatat |
41342168 |
T |
|
| Q |
211 |
caaatgctttattttataa |
229 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41342169 |
caaatgctttattttataa |
41342187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 286 - 321
Target Start/End: Original strand, 41342185 - 41342220
Alignment:
| Q |
286 |
taagaatcaaatgctctaattaaaaatggttaaagt |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
41342185 |
taagaatcaaatgctctaattaaaaatggttaaagt |
41342220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University